Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T82393 | Target Info | |||
| Target Name | TNF alpha converting enzyme (ADAM17) | ||||
| Synonyms | TNFalpha converting enzyme; TNF-alpha-converting enzyme; TNF-alpha converting enzyme; TNF-alpha convertase; TACE; Snake venom-like protease; Disintegrin and metalloproteinase domain-containing protein 17; CSVP; CD156b antigen; CD156b; ADAM 17; A disintegrin and metalloproteinase domain 17 | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | ADAM17 | ||||
| Biochemical Class | Peptidase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-122-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggagugugacaaugguguuug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | The overexpression of miR-122-5p resulted in the decreased protein level of target ADAM17. | [1] | |||
| Evidence Score (E-score) | 4 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; | [2] | |||
| 3 | Western Blot | [3] | |||
| 4 | Western Blot | [4] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-W (BCL-W) | Target Info | |||
| Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | ||||
| miRNA Mature ID | hsa-miR-145-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | guccaguuuucccaggaaucccu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-145 represses ADAM17 expression by binding the 3'UTR of ADAM17 mRNA. | [7] | |||
| Evidence Score (E-score) | 4 | + | |||
| 1 | Immunohistochemistry | [5] | |||
| 2 | Luciferase Reporter Assay | [6] | |||
| 3 | Luciferase Reporter Assay; Western Blot | [7] | |||
| 4 | RT-PCR; Western Blot | [8] | |||
| Representative Target(s) Regulated by This miRNA | A proliferation-inducing ligand (APRIL) | Target Info | |||
| Alkaline phosphatase (ALPPL2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-152-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ucagugcaugacagaacuugg | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | ADAM17 is identified as a target of miR-152 and was inversely correlated with miR-152 in NSCLC tissues. | [10] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot | [9] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [10] | |||
| Representative Target(s) Regulated by This miRNA | Activated leukocyte cell adhesionmolecule (ALCAM) | Target Info | |||
| Dickkopf-related protein 1 (DKK1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-338-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uccagcaucagugauuuuguug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | ADAM17 is a direct target of miR-338-3p, and ADAM17 overexpression partially attenuated the tumor suppressive effect of miR-338-3p in gastric cancer cells. | [11] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [11] | |||
| Representative Target(s) Regulated by This miRNA | G1/S-specific cyclin-D1 (CCND1) | Target Info | |||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82. | ||||
| REF 2 | The microRNA network and tumor metastasis. Oncogene. 2010 Feb 18;29(7):937-48. | ||||
| REF 3 | Circulating microRNAs as Potential Diagnostic and Prognostic Biomarkers in Hepatocellular Carcinoma. Sci Rep. 2019 Jul 18;9(1):10464. | ||||
| REF 4 | Delivery of Liver-Specific miRNA-122 Using a Targeted Macromolecular Prodrug toward Synergistic Therapy for Hepatocellular Carcinoma. ACS Appl Mater Interfaces. 2019 Mar 20;11(11):10578-10588. | ||||
| REF 5 | miR145 targets the SOX9/ADAM17 axis to inhibit tumor-initiating cells and IL-6-mediated paracrine effects in head and neck cancer. Cancer Res. 2013 Jun 1;73(11):3425-40. | ||||
| REF 6 | MicroRNA-145 targets the metalloprotease ADAM17 and is suppressed in renal cell carcinoma patients. Neoplasia. 2013 Feb;15(2):218-30. | ||||
| REF 7 | MiR-145 reduces ADAM17 expression and inhibits in vitro migration and invasion of glioma cells. Oncol Rep. 2013 Jan;29(1):67-72. | ||||
| REF 8 | MicroRNA-145 overexpression attenuates apoptosis and increases matrix synthesis in nucleus pulposus cells. Life Sci. 2019 Mar 15;221:274-283. | ||||
| REF 9 | MiR-152 reduces human umbilical vein endothelial cell proliferation and migration by targeting ADAM17. FEBS Lett. 2014 Jun 5;588(12):2063-9. | ||||
| REF 10 | MicroRNA-152 targets ADAM17 to suppress NSCLC progression. FEBS Lett. 2014 May 21;588(10):1983-8. | ||||
| REF 11 | MiR-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10922-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.