Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T80526 |
Target Info
|
| Target Name |
Casein kinase II alpha prime (CSNK2A2) |
| Synonyms |
Casein kinase II subunit alpha'; CK2A2; CK II alpha' |
| Target Type |
Patented-recorded Target |
| Gene Name |
CSNK2A2 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-1228-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucacaccugccucgcccccc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-1228 suppresses CK2A2 expression in SGC-7901. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Microarray |
[2] |
| Representative Target(s) Regulated by This miRNA |
BMP-2-inducible protein kinase (BMP2K)
|
Target Info
|
|
|
Casein kinase II alpha prime (CSNK2A2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Restoration of miR-1228* expression suppresses epithelial-mesenchymal transition in gastric cancer. PLoS One. 2013;8(3):e58637.
|
| REF 2 |
A comparative characterization of the circulating miRNome in whole blood and serum of HCC patients. Sci Rep. 2019 Jun 4;9(1):8265.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
