Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T80395 | Target Info | |||
| Target Name | GAP-associated tyrosine phosphoprotein p62 (KHDRBS1) | ||||
| Synonyms | p68; p21 Ras GTPaseactivating proteinassociated p62; p21 Ras GTPase-activating protein-associated p62; Srcassociated in mitosis 68 kDa protein; Src-associated in mitosis 68 kDa protein; Sam68; KH domaincontaining, RNAbinding, signal transductionassociated protein 1; KH domain-containing, RNA-binding, signal transduction-associated protein 1; GAPassociated tyrosine phosphoprotein p62 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | KHDRBS1 | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-203a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | gugaaauguuuaggaccacuag | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-203 inhibits the malignant progression of neuroblastoma by targeting KHDRBS1. | [1] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | qRT-PCR | [1] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
| Apoptosis regulator Bcl-W (BCL-W) | Target Info | ||||
| miRNA Mature ID | hsa-miR-204-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | gcugggaaggcaaagggacgu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot; Immunofluorescent Assay | [2] | |||
| Representative Target(s) Regulated by This miRNA | GAP-associated tyrosine phosphoprotein p62 (KHDRBS1) | Target Info | |||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA-203 inhibits the malignant progression of neuroblastoma by targeting Sam68. Mol Med Rep. 2015 Oct;12(4):5554-60. | ||||
| REF 2 | CONSORT: Sam68 Is Directly Regulated by MiR-204 and Promotes the Self-Renewal Potential of Breast Cancer Cells by Activating the Wnt/Beta-Catenin Signaling Pathway. Medicine (Baltimore). 2015 Dec;94(49):e2228. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.