miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-204-3p | ||||
| miRNA Stemloop AC | MI0000284 | ||||
| miRNA Stemloop ID | hsa-mir-204 | ||||
| Sequence | gcugggaaggcaaagggacgu | ||||
| TTD Target(s) Regulated by This miRNA | GAP-associated tyrosine phosphoprotein p62 (KHDRBS1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Cyclic AMP-dependent transcription factor ATF-2 | Regulated Protein | [2] | ||
| Cyclic AMP-dependent transcription factor ATF-2 | Regulated Protein | [3] | |||
| Protein phosphatase 1K, mitochondrial | Regulated Protein | [4] | |||
| Regulator of G-protein signaling 5 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | CONSORT: Sam68 Is Directly Regulated by MiR-204 and Promotes the Self-Renewal Potential of Breast Cancer Cells by Activating the Wnt/Beta-Catenin Signaling Pathway. Medicine (Baltimore). 2015 Dec;94(49):e2228. | ||||
| REF 2 | Lactic Acid Suppresses IL-33-Mediated Mast Cell Inflammatory Responses via Hypoxia-Inducible Factor-1-Dependent miR-155 Suppression.J Immunol. 2016 Oct 1;197(7):2909-17. | ||||
| REF 3 | miR-204 suppresses the development and progression of human glioblastoma by targeting ATF2.Oncotarget. 2016 Oct 25;7(43):70058-70065. | ||||
| REF 4 | Regulation of PP2Cm expression by miRNA-204/211 and miRNA-22 in mouse and human cells.Acta Pharmacol Sin. 2015 Dec;36(12):1480-6. | ||||
| REF 5 | MicroRNAs that target RGS5.Iran J Basic Med Sci. 2015 Feb;18(2):108-14. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.