Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T79307 |
Target Info
|
| Target Name |
Serine/threonine-protein kinase ULK1 (ULK1) |
| Synonyms |
hATG1; Unc-51-like kinase 1; KIAA0722; Autophagy-related protein 1 homolog; ATG1 |
| Target Type |
Literature-reported Target |
| Gene Name |
ULK1 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-106a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aaaagugcuuacagugcagguag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
PAR-CLIP; HITS-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-106a targets autophagy and enhances sensitivity of lung cancer cells to Src inhibitors. Lung Cancer. 2017 May;107:73-83.
|
| REF 2 |
A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
