Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T78150 |
Target Info
|
Target Name |
Direct IAP-binding protein with low pI (DIABLO) |
Synonyms |
Smac protein; Smac; Second mitochondria-derived activator of caspase; Direct IAP binding protein with low pI; Diablo homolog, mitochondrial |
Target Type |
Literature-reported Target |
Gene Name |
DIABLO |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccaucugaaaucgguua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-29 targets DIABLO and DIABLO was significantly upregulated in DM1 patients. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
References |
Top |
REF 1 |
Dysregulation and cellular mislocalization of specific miRNAs in myotonic dystrophy type 1. Neuromuscul Disord. 2011 Feb;21(2):81-8.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.