Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T77645 |
Target Info
|
Target Name |
TRAIL receptor 1 (TRAIL-R1) |
Synonyms |
Tumor necrosis factor receptor superfamily member 10A; TRAILR1; TNF-related apoptosis-inducing ligand receptor 1; Death receptor 4; DR4; CD261; APO2 |
Target Type |
Clinical trial Target |
Gene Name |
TNFRSF10A |
Biochemical Class |
Cytokine receptor |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-106b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcugacagugcagau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
References |
Top |
REF 1 |
MiR-106b inhibitors sensitize TRAIL-induced apoptosis in hepatocellular carcinoma through increase of death receptor 4. Oncotarget. 2017 Jun 27;8(26):41921-41931.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.