Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T75613 Target Info
Target Name Laminin gamma-2 subunit (LAMC2)
Synonyms Nicein subunit gamma; Large adhesive scatter factor 140 kDa subunit; Laminin5 subunit gamma; Laminin-5 subunit gamma; Laminin subunit gamma2; Laminin subunit gamma-2; Laminin B2t chain; Ladsin 140 kDa subunit; LAMNB2; LAMB2T; Kalinin/nicein/epiligrin 100 kDa subunit; Kalinin subunit gamma; Epiligrin subunit gamma; Cellscattering factor 140 kDa subunit; Cell-scattering factor 140 kDa subunit; CSF 140 kDa subunit
Target Type Literature-reported Target
Gene Name LAMC2
UniProt ID
Q13753
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Western Blot; Luciferase Reporter Assay; qRT-PCR [1]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-199b-5p miRNA Info
miRNA Mature AC
MIMAT0000263
Sequence cccaguguuuagacuaucuguuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Epithelial discoidin domain receptor 1 (DDR1) Target Info
DDR1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-622 miRNA Info
miRNA Mature AC
MIMAT0003291
Sequence acagucugcugagguuggagc
miRNA Species Homo sapiens
Regulation Mechanism Knockdown of Drosha significantly reduced cell invasion via an EGFR-ERK1/2-MMP7 signaling pathway, which is partly due to miR-622 targeting LAMC2. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
Laminin gamma-2 subunit (LAMC2) Target Info
LAMC2_HUMAN
References  Top
REF 1 miR-146a functions as a tumor suppressor in prostate cancer by targeting Rac1. Prostate. 2014 Dec;74(16):1613-21.
REF 2 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
REF 3 Tumour-suppressive microRNA-29s inhibit cancer cell migration and invasion by targeting laminin-integrin signalling in head and neck squamous cell carcinoma. Br J Cancer. 2013 Nov 12;109(10):2636-45.
REF 4 A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 5 Nuclear Drosha enhances cell invasion via an EGFR-ERK1/2-MMP7 signaling pathway induced by dysregulated miRNA-622/197 and their targets LAMC2 and CD82 in gastric cancer. Cell Death Dis. 2017 Mar 2;8(3):e2642.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.