Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T73414 |
Target Info
|
Target Name |
Proliferation marker protein Ki-67 (MKI67) |
Synonyms |
Antigen identified by monoclonal antibody Ki-67; Antigen Ki67; Antigen KI-67 |
Target Type |
Literature-reported Target |
Gene Name |
MKI67 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-519d-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugccucccuuuagagug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-519d was confirmed to be a direct regulator of MKi67. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
GFP Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Calcium-release activated calcium channel (CRACM)
|
Target Info
|
|
E2F transcription factor 1 (E2F1)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-519d targets MKi67 and suppresses cell growth in the hepatocellular carcinoma cell line QGY-7703. Cancer Lett. 2011 Aug 28;307(2):182-90.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.