Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T72779 Target Info
Target Name Maspin (SERPINB5)
Synonyms Serpin B5; Protease inhibitor 5; Peptidase inhibitor 5; PI5; PI-5
Target Type Literature-reported Target
Gene Name SERPINB5
Biochemical Class Serpin protein
UniProt ID
P36952
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-21-5p by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target SERPINB5. [2]
Evidence Score (E-score) 6 +
1 ChIP; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 ChIP; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Immunoprecipitation; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay [4]
5 Reporter Assay [5]
6 Reporter Assay; Western Blot; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 ChIP; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
References  Top
REF 1 Nuclear IKK mediates microRNA-7/-103/107/21 inductions to downregulate maspin expression in response to HBx overexpression. Oncotarget. 2016 Aug 30;7(35):56309-56323.
REF 2 MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008 Mar;18(3):350-9.
REF 3 miRNA-7/21/107 contribute to HBx-induced hepatocellular carcinoma progression through suppression of maspin. Oncotarget. 2015 Sep 22;6(28):25962-74.
REF 4 Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics. 2009 Mar;9(5):1374-84.
REF 5 MicroRNA-21 plays a role in hypoxia-mediated pulmonary artery smooth muscle cell proliferation and migration. Am J Physiol Lung Cell Mol Physiol. 2010 Dec;299(6):L861-71.
REF 6 MicroRNA-21 targets peroxisome proliferators-activated receptor-alpha in an autoregulatory loop to modulate flow-induced endothelial inflammation. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10355-60.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.