Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T72319 |
Target Info
|
| Target Name |
Chromobox protein homolog 7 (CBX7) |
| Synonyms |
Chromobox 7 |
| Target Type |
Literature-reported Target |
| Gene Name |
CBX7 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-18a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acugcccuaagugcuccuucugg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-18a binds to CBX7 3'UTR. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
|
Chromobox protein homolog 7 (CBX7)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-421 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucaacagacauuaauugggcgc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The downregulation of miR-421 resulted in the changed protein level of target CBX7. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
|
Caspase-3 (CASP3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The malignancy of miR-18a in human glioblastoma via directly targeting CBX7. Am J Cancer Res. 2017 Jan 1;7(1):64-76.
|
| REF 2 |
Increased expression of miR-421 in human gastric carcinoma and its clinical association. J Gastroenterol. 2010;45(1):17-23.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
