Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T72168 Target Info
Target Name Mineralocorticoid receptor (MR)
Synonyms Nuclear receptor subfamily 3 group C member 2; Mineralocorticoid receptor; MLR; MCR; Inner ear mineralocorticoid receptor; Delta
Target Type Successful Target
Gene Name NR3C2
Biochemical Class Nuclear hormone receptor
UniProt ID
P08235
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-301b-3p miRNA Info
miRNA Mature AC
MIMAT0004958
Sequence cagugcaaugauauugucaaagc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of pri-miR-301b suppressed both mRNA and protein expression of NR3C2. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
Mineralocorticoid receptor (MR) Target Info
MCR_HUMAN
References  Top
REF 1 A Novel MIF Signaling Pathway Drives the Malignant Character of Pancreatic Cancer by Targeting NR3C2. Cancer Res. 2016 Jul 1;76(13):3838-50.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.