Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T70490 |
Target Info
|
| Target Name |
Dipeptidyl peptidase I (CTSC) |
| Synonyms |
Dipeptidyl transferase; Dipeptidyl peptidase 1; DPPI; DPP-I; Cysteine protease dipeptidyl peptidase I; Cathepsin J; Cathepsin C; CPPI |
| Target Type |
Clinical trial Target |
| Gene Name |
CTSC |
| Biochemical Class |
Peptidase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuaugccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target CTSC. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR |
[1] |
| Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Network modeling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis. PLoS Comput Biol. 2010 Apr 1;6(4):e1000730.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
