Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T70062 |
Target Info
|
| Target Name |
Reticulon-4 (RTN4) |
| Synonyms |
SP1507; My043 |
| Target Type |
Clinical trial Target |
| Gene Name |
RTN4 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
A significantly increased luciferase activity was observed in gene RTN4 containing perfect 7-mer seed matches upon miR-21 inhibition. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics. 2009 Mar;9(5):1374-84.
|
| REF 2 |
MicroRNAs and potential target interactions in psoriasis. J Dermatol Sci. 2010 Jun;58(3):177-85.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
