Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T69580 Target Info
Target Name Fibroblast growth factor-8 (FGF8)
Synonyms Heparin-binding growth factor 8; HBGF-8; Fibroblast growth factor 8; FGF-8; Androgen-induced growth factor; AIGF
Target Type Literature-reported Target
Gene Name FGF8
Biochemical Class Growth factor
UniProt ID
P55075
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism HBXIP upregulates FGF8 through inhibiting miR-503. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
References  Top
REF 1 The oncoprotein HBXIP enhances angiogenesis and growth of breast cancer through modulating FGF8 and VEGF. Carcinogenesis. 2014 May;35(5):1144-53.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.