Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T69184 |
Target Info
|
| Target Name |
Long transient receptor potential channel 3 (TRPM3) |
| Synonyms |
Transient receptor potential cation channel subfamily M member 3; Melastatin-2; MLSN2; LTrpC3; LTrpC-3; KIAA1616 |
| Target Type |
Literature-reported Target |
| Gene Name |
TRPM3 |
| Biochemical Class |
Transient receptor potential catioin channel |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuaugccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
TRPM3 is a direct target of its own intronic miR-204. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
qRT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The dual regulatory role of miR-204 in cancer. Tumour Biol. 2016 Sep;37(9):11667-11677.
|
| REF 2 |
TRPM3 and miR-204 establish a regulatory circuit that controls oncogenic autophagy in clear cell renal cell carcinoma. Cancer Cell. 2014 Nov 10;26(5):738-53.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
