Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T69128 Target Info
Target Name Proto-oncogene c-Ros (ROS1)
Synonyms c-Ros receptor tyrosine kinase; Receptor tyrosine kinase c-ros oncogene 1; ROS; Proto-oncogene tyrosine-protein kinase ROS; Proto-oncogene c-Ros-1; MCF3
Target Type Successful Target
Gene Name ROS1
Biochemical Class Kinase
UniProt ID
P08922
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-300 miRNA Info
miRNA Mature AC
MIMAT0004903
Sequence uauacaagggcagacucucucu
miRNA Species Homo sapiens
Regulation Mechanism miR-300 overexpression decreased the luciferase activity of WT 3'UTR of ROS1 construct, however; overexpression of miR-300 did not change the luciferase activity of MUT 3'UTR of ROS1 construct. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Bromodomain-containing protein 7 (BRD7) Target Info
BRD7_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism ROS1 is a direct downstream target of miR-33a. miR-33a suppressed the expression of luciferase containing the 3'UTR of ROS1. [2]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
References  Top
REF 1 MiR-300 suppresses laryngeal squamous cell carcinoma proliferation and metastasis by targeting ROS1. Am J Transl Res. 2016 Sep 15;8(9):3903-3911.
REF 2 MiR-33a suppresses breast cancer cell proliferation and metastasis by targeting ADAM9 and ROS1. Protein Cell. 2015 Dec;6(12):881-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.