Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T68513 Target Info
Target Name S100 calcium-binding protein A6 (S100A6)
Synonyms Protein S100-A6; Prolactin receptor-associated protein; PRA; MLN 4; Growth factor-inducible protein 2A9; Calcyclin; CACY
Target Type Literature-reported Target
Gene Name S100A6
Biochemical Class S100 calcium-binding protein
UniProt ID
P06703
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 HITS-CLIP [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
References  Top
REF 1 Progesterone downregulation of miR-141 contributes to expansion of stem-like breast cancer cells through maintenance of progesterone receptor and Stat5a. Oncogene. 2015 Jul;34(28):3676-87.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.