Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T65883 |
Target Info
|
| Target Name |
Claudin-18 (CLDN18) |
| Synonyms |
UNQ778/PRO1572; Claudin18 |
| Target Type |
Clinical trial Target |
| Gene Name |
CLDN18 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-122-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggagugugacaaugguguuug
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
|
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-1303 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuuagagacggggucuugcucu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Downregulation of miR-1303 can inhibit proliferation, migration and invasion of GC cells by targeting CLDN18. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Autophagy-related 2B (ATG2B)
|
Target Info
|
|
|
Claudin-18 (CLDN18)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
|
| REF 2 |
miR-1303 targets claudin-18 gene to modulate proliferation and invasion of gastric cancer cells. Dig Dis Sci. 2014 Aug;59(8):1754-63.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
