Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T65198 |
Target Info
|
Target Name |
Pro-neuregulin-1 (Pro-NRG1) |
Synonyms |
SMDF (20-241); Pro-neuregulin-1, membrane-bound isoform (20-241); NDF (20-241); Heregulin (20-241); HRGA (20-241); HGL (20-241); GGF (20-241) |
Target Type |
Clinical trial Target |
Gene Name |
NRG1 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acaggugagguucuugggagcc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
NRG1 is a direct target of miR-125a-3p. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Enhancer of zeste homolog 2 (EZH2)
|
Target Info
|
|
Fyn tyrosine protein kinase (FYN)
|
Target Info
|
|
References |
Top |
REF 1 |
MiR-125a-3p regulates glioma apoptosis and invasion by regulating Nrg1. PLoS One. 2015 Jan 5;10(1):e0116759.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.