Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T65084 |
Target Info
|
| Target Name |
Ubiquitin thioesterase OTU1 (YOD1) |
| Synonyms |
PRO0907; OTUD2; OTU domain-containing protein 2; HsHIN7; HIV-1-induced protease 7; HIN7; HIN-7; DUBA8; DUBA-8 |
| Target Type |
Literature-reported Target |
| Gene Name |
YOD1 |
| Biochemical Class |
Peptidase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
YOD1 was demostrated as the target of miR-21. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Microarray |
[1] |
| 2 |
qRT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
|
| REF 2 |
miR-21 regulates chronic hypoxia-induced pulmonary vascular remodeling. Am J Physiol Lung Cell Mol Physiol. 2012 Mar 15;302(6):L521-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
