Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T64268 Target Info
Target Name Insulin-like growth factor-binding protein 2 (IGFBP2)
Synonyms IGFBP-2; IGF-binding protein 2; IBP2; IBP-2; BP2
Target Type Literature-reported Target
Gene Name IGFBP2
Biochemical Class Insulin-like growth factor binding
UniProt ID
P18065
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism miR-126 directly targets gene IGFBP2. [1]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-491-3p miRNA Info
miRNA Mature AC
MIMAT0004765
Sequence cuuaugcaagauucccuucuac
miRNA Species Homo sapiens
Regulation Mechanism IGFBP2 protein was downregulated by miR-491-3p. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
Insulin-like growth factor-binding protein 2 (IGFBP2) Target Info
IBP2_HUMAN
References  Top
REF 1 A microRNA regulon that mediates endothelial recruitment and metastasis by cancer cells. Nature. 2011 Dec 14;481(7380):190-4.
REF 2 miR-126 and miR-126* repress recruitment of mesenchymal stem cells and inflammatory monocytes to inhibit breast cancer metastasis. Nat Cell Biol. 2013 Mar;15(3):284-94.
REF 3 The miR-204-3p-targeted IGFBP2 pathway is involved in xanthohumol-induced glioma cell apoptotic death. Neuropharmacology. 2016 Nov;110(Pt A):362-375.
REF 4 Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.