Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T62912 |
Target Info
|
| Target Name |
Corticotropin-lipotropin (POMC) |
| Synonyms |
Pro-opiomelanocortin |
| Target Type |
Literature-reported Target |
| Gene Name |
POMC |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-488-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uugaaaggcuauuucuugguc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-488 reduced the luciferase activity of the pro-opiomelanocortin POMC constructs. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Corticotropin-lipotropin (POMC)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-488 determines coat pigmentation by down-regulating the pigment-producing gene pro-opiomelanocortin. Cell Mol Biol (Noisy-le-grand). 2016 Oct 31;62(12):37-43.
|
| REF 2 |
Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
