miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-488-3p | ||||
| miRNA Stemloop AC | MI0003123 | ||||
| miRNA Stemloop ID | hsa-mir-488 | ||||
| Sequence | uugaaaggcuauuucuugguc | ||||
| TTD Target(s) Regulated by This miRNA | Corticotropin-lipotropin (POMC) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 11 | Regulated Protein | [2] | ||
| Eukaryotic translation initiation factor 3 subunit A | Regulated Protein | [3] | |||
| Paired box protein Pax-6 | Regulated Protein | [4] | |||
| Zinc transporter ZIP8 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33. | ||||
| REF 2 | Hypoxia-inducible microRNA-488 regulates apoptosis by targeting Bim in osteosarcoma. Cell Oncol (Dordr). 2016 Oct;39(5):463-471. | ||||
| REF 3 | MiR-488 inhibits proliferation and cisplatin sensibility in non-small-cell lung cancer (NSCLC) cells by activating the eIF3a-mediated NER signaling pathway.Sci Rep. 2017 Jan 11;7:40384. | ||||
| REF 4 | miR-488 acts as a tumor suppressor gene in gastric cancer.Tumour Biol. 2016 Jul;37(7):8691-8. | ||||
| REF 5 | MicroRNA-488 regulates zinc transporter SLC39A8/ZIP8 during pathogenesis of osteoarthritis.J Biomed Sci. 2013 May 20;20:31. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.