Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T62746 |
Target Info
|
Target Name |
Rotamase F (PPIF) |
Synonyms |
Peptidylprolyl cistrans isomerase F, mitochondrial; Peptidyl-prolyl cis-trans isomerase F, mitochondrial; PPIase F; Mitochondrial cyclophilin; Cyclophilin F; CyPM; CyP-M; CyP-D; CYP3 |
Target Type |
Literature-reported Target |
Gene Name |
PPIF |
Biochemical Class |
Cis-trans-isomerase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcuuaucagacugauguuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Cotransfection with pre-miR-21 specifically decreased luciferase levels of the reporter of PPIF. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR |
[1] |
2 |
Microarray |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res. 2008 Oct 1;68(19):8164-72.
|
REF 2 |
MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.