Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T62241 Target Info
Target Name Interleukin-25 (IL25)
Synonyms UNQ3120/PRO10272; Interleukin-17E; IL17E; IL-25; IL-17E
Target Type Clinical trial Target
Gene Name IL25
Biochemical Class Cytokine: interleukin
UniProt ID
Q9H293
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-31 directly regulated IL-25 expression by binding to its messenger RNA 3'-untranslated region. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
References  Top
REF 1 The signaling axis of microRNA-31/interleukin-25 regulates Th1/Th17-mediated inflammation response in colitis. Mucosal Immunol. 2017 Jul;10(4):983-995.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.