Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T62193 |
Target Info
|
| Target Name |
Aromatic-L-amino-acid decarboxylase (DDC) |
| Synonyms |
DOPA decarboxylase; AADC |
| Target Type |
Successful Target |
| Gene Name |
DDC |
| Biochemical Class |
Carbon-carbon lyase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guccaguuuucccaggaaucccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-145 regulates DDC mRNA expression and potentially this occurs by recognizing its mRNA as a target. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qPCR |
[1] |
| 2 |
qRT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Dual strands of the miR-145 duplex (miR-145-5p and miR-145-3p) regulate oncogenes in lung adenocarcinoma pathogenesis. J Hum Genet. 2018 Oct;63(10):1015-1028.
|
| REF 2 |
Human L-DOPA decarboxylase mRNA is a target of miR-145: A prediction to validation workflow. Gene. 2015 Jan 10;554(2):174-80.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
