Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T61033 |
Target Info
|
| Target Name |
Ciliary neurotrophic factor receptor alpha (CNTFR) |
| Synonyms |
Ciliary neurotrophic factor receptor subunit alpha; CNTFR-alpha; CNTFR alpha; CNTF receptor subunit alpha |
| Target Type |
Clinical trial Target |
| Gene Name |
CNTFR |
| Biochemical Class |
Cytokine receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-708-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aaggagcuuacaaucuagcuggg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-708 inhibited luciferase reporter activity by binding to the 3'UTR of CNTFR and suppressed the protein levels of CNTFR. miR-708 can inhibit reporter activity through the 394'00 bp region of the 3'UTR of CNTFR mRNA. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Overexpression of miR-708 and its targets in the childhood common precursor B-cell ALL. Pediatr Blood Cancer. 2013 Dec;60(12):2060-7.
|
| REF 2 |
[The expression and regulatory mechanism of microRNA-708 in pediatric common B-cell acute lymphoblastic leukemia]. Zhonghua Xue Ye Xue Za Zhi. 2013 Feb;34(2):138-43.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
