Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T60897 |
Target Info
|
| Target Name |
Protein tyrosine phosphatase IVA 2 (PRL-2) |
| Synonyms |
Protein-tyrosine phosphatase of regenerating liver 2; Protein-tyrosine phosphatase 4a2; Protein tyrosine phosphatase type IVA 2; PTPCAAX2; PTP(CAAXII); PRL2; OV-1; HU-PP-1; BM-008 |
| Target Type |
Literature-reported Target |
| Gene Name |
PTP4A2 |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guccaguuuucccaggaaucccu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
