Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T59720 Target Info
Target Name Fragile histidine triad protein (FHIT)
Synonyms Fragile histidinetriad protein; Fragile histidinetriad (FHIT) gene; Dinucleosidetriphosphatase; Diadenosine 5',5'''-P1,P3-triphosphate hydrolase; Bis(5'-adenosyl)-triphosphatase; AP3AASE; AP3A hydrolase
Target Type Successful Target
Gene Name FHIT
Biochemical Class Acid anhydride hydrolase
UniProt ID
P49789
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism miRNA-143 directly targets FHIT gene. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-331-3p miRNA Info
miRNA Mature AC
MIMAT0000760
Sequence gccccugggccuauccuagaa
miRNA Species Homo sapiens
Regulation Mechanism miRNA-331 directly targets FHIT gene. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-625-5p miRNA Info
miRNA Mature AC
MIMAT0003294
Sequence agggggaaaguucuauagucc
miRNA Species Homo sapiens
Regulation Mechanism miRNA-625 directly targets FHIT gene. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Fragile histidine triad protein (FHIT) Target Info
FHIT_HUMAN
High mobility group protein HMG-I/Y (HMGA1) Target Info
HMGA1_HUMAN
References  Top
REF 1 microRNA-143 protects cells from DNA damage-induced killing by downregulating FHIT expression. Cancer Biother Radiopharm. 2011 Jun;26(3):365-72.
REF 2 Expression and clinical significance of miRNAs that may be associated with the FHIT gene in breast cancer. Gene. 2016 Sep 30;590(2):278-84.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.