Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T58454 Target Info
Target Name Fibroblast growth factor receptor 2 (FGFR2)
Synonyms Keratinocyte growth factor receptor 2; Keratinocyte growth factor receptor; KSAM; KGFR; K-sam; FGFR-2; FGF-2 receptor; CD332; BEK
Target Type Successful Target
Gene Name FGFR2
Biochemical Class Kinase
UniProt ID
P21802
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-19b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004491
Sequence aguuuugcagguuugcauccagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Caspase-8 (CASP8) Target Info
CASP8_HUMAN
Fibroblast growth factor receptor 2 (FGFR2) Target Info
FGFR2_HUMAN
References  Top
REF 1 MiR-19b-1 inhibits angiogenesis by blocking cell cycle progression of endothelial cells. Biochem Biophys Res Commun. 2012 Jan 13;417(2):771-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.