Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T56290 Target Info
Target Name Homeobox protein Hox-A11 (HOXA11)
Synonyms Homeobox protein HoxA11; Homeobox protein Hox1I; Homeobox protein Hox-1I; HOX1I
Target Type Literature-reported Target
Gene Name HOXA11
UniProt ID
P31270
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-181a-5p miRNA Info
miRNA Mature AC
MIMAT0000256
Sequence aacauucaacgcugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-181a-5p by mature miRNA transfection resulted in the decreased protein level of target HOXA11; The Underexpression by LNA Antisense miRNA Oligonucleotides resulted in the increased protein level of target HOX11. [1]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
References  Top
REF 1 The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nat Cell Biol. 2006 Mar;8(3):278-84.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.