Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T56108 |
Target Info
|
Target Name |
Tripartite motif-containing 24 (TRIM24) |
Synonyms |
Tripartite motif-containing protein 24; Transcription intermediary factor 1-alpha; TIF1A; TIF1-alpha; TIF1; RNF82; RING-type E3 ubiquitin transferase TIF1-alpha; RING finger protein 82; E3 ubiquitin-protein ligase TRIM24 |
Target Type |
Literature-reported Target |
Gene Name |
TRIM24 |
Biochemical Class |
Acyltransferase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-511-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugucuuuugcucugcaguca
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Tumor suppressive role of miR-511 in gastric cancer by suppressing TRIM24, suggesting that this novel miR-511/TRIM24 axis is critical in the control of gastric cancer tumorigenesis. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
FK506-binding protein 5 (FKBP5)
|
Target Info
|
|
Liver organic anion transporter 1 (SLCO1B1)
|
Target Info
|
|
References |
Top |
REF 1 |
Regulation of TRIM24 by miR-511 modulates cell proliferation in gastric cancer. J Exp Clin Cancer Res. 2017 Jan 23;36(1):17.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.