Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55922 Target Info
Target Name S-adenosylmethionine decarboxylase proenzyme (AMD1)
Synonyms SamDC; S-adenosylmethioninedecarboxylase; AdoMetDC; AMD
Target Type Successful Target
Gene Name AMD1
Biochemical Class Carbon-carbon lyase
UniProt ID
P17707
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-762 miRNA Info
miRNA Mature AC
MIMAT0010313
Sequence ggggcuggggccggggccgagc
miRNA Species Homo sapiens
Regulation Mechanism AMD1 translational down-regulation is mediated by miR-762. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA S-adenosylmethionine decarboxylase proenzyme (AMD1) Target Info
DCAM_HUMAN
References  Top
REF 1 AMD1 is essential for ESC self-renewal and is translationally down-regulated on differentiation to neural precursor cells. Genes Dev. 2012 Mar 1;26(5):461-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.