Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55398 Target Info
Target Name Renal carcinoma antigen NY-REN-64 (IRAK-4)
Synonyms Interleukin-1 receptor-associated kinase 4; IRAK-4
Target Type Clinical trial Target
Gene Name IRAK4
Biochemical Class Kinase
UniProt ID
Q9NWZ3
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10a-3p miRNA Info
miRNA Mature AC
MIMAT0004555
Sequence caaauucguaucuaggggaaua
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Renal carcinoma antigen NY-REN-64 (IRAK-4) Target Info
IRAK4_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism Sustained expression of miR-132 was responsible for inducing tolerance to subsequent PGN challenge. IRAK4 was identified and validated as a target of miR-132 by luciferase reporter assay and seed-sequence mutagenesis of the reporter. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-212-3p miRNA Info
miRNA Mature AC
MIMAT0000269
Sequence uaacagucuccagucacggcc
miRNA Species Homo sapiens
Regulation Mechanism Sustained expression of miR-212 was responsible for inducing tolerance to subsequent PGN challenge. IRAK4 was identified and validated as a target of miR-212 by luciferase reporter assay and seed-sequence mutagenesis of the reporter. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Acetylcholinesterase (AChE) Target Info
ACES_HUMAN
Adenylate cyclase type 1 (ADCY1) Target Info
ADCY1_HUMAN
References  Top
REF 1 A novel NF-B/YY1/microRNA-10a regulatory circuit in fibroblast-like synoviocytes regulates inflammation in rheumatoid arthritis. Sci Rep. 2016 Jan 29;6:20059.
REF 2 Regulation of TLR2-mediated tolerance and cross-tolerance through IRAK4 modulation by miR-132 and miR-212. J Immunol. 2013 Feb 1;190(3):1250-63.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.