Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T55244 |
Target Info
|
| Target Name |
Gamma-Histone H2AX (H2AFX) |
| Synonyms |
Phosphorylation of H2AX; Histone H2AX; Histone H2A.x; H2a/x; H2AX |
| Target Type |
Literature-reported Target |
| Gene Name |
H2AFX |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-328-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cuggcccucucugcccuuccgu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
PCR; Western Blot |
[1] |
| 2 |
Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
|
Beta-secretase 1 (BACE1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR 328 3p enhances the radiosensitivity of osteosarcoma and regulates apoptosis and cell viability via H2AX. Oncol Rep. 2018 Feb;39(2):545-553.
|
| REF 2 |
miR-24-mediated downregulation of H2AX suppresses DNA repair in terminally differentiated blood cells. Nat Struct Mol Biol. 2009 May;16(5):492-8.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
