Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55068 Target Info
Target Name Voltage-gated potassium channel Kv7.5 (KCNQ5)
Synonyms Voltage-gated potassium channel subunit Kv7.5; Potassium voltage-gated channel subfamily KQT member 5; Potassium channel subunit alpha KvLQT5; KQT-like 5
Target Type Literature-reported Target
Gene Name KCNQ5
Biochemical Class Voltage-gated ion channel
UniProt ID
Q9NR82
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-190a-5p miRNA Info
miRNA Mature AC
MIMAT0000458
Sequence ugauauguuugauauauuaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Insulin-like growth factor-I (IGF1) Target Info
IGF1_HUMAN
References  Top
REF 1 MicroRNA-190 regulates hypoxic pulmonary vasoconstriction by targeting a voltage-gated K channel in arterial smooth muscle cells. J Cell Biochem. 2014 Jun;115(6):1196-205.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.