miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-190a-5p | ||||
| miRNA Stemloop AC | MI0000486 | ||||
| miRNA Stemloop ID | hsa-mir-190a | ||||
| Sequence | ugauauguuugauauauuaggu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [1] | |
| Voltage-gated potassium channel Kv7.5 (KCNQ5) | Literature-reported Target | Target Info | [2] | ||
| CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Forkhead box protein P2 | Regulated Protein | [4] | ||
| PH domain leucine-rich repeat-containing protein phosphatase 1 | Regulated Protein | [5] | |||
| Serine/threonine-protein kinase MARK2 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | The synergistic regulation of VEGF-mediated angiogenesis through miR-190 and target genes. RNA. 2014 Aug;20(8):1328-36. | ||||
| REF 2 | MicroRNA-190 regulates hypoxic pulmonary vasoconstriction by targeting a voltage-gated K channel in arterial smooth muscle cells. J Cell Biochem. 2014 Jun;115(6):1196-205. | ||||
| REF 3 | Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. EMBO J. 2007 Aug 8;26(15):3699-708. | ||||
| REF 4 | MicroRNA-190 regulates FOXP2 genes in human gastric cancer.Onco Targets Ther. 2016 Jun 20;9:3643-51. | ||||
| REF 5 | miR-190-mediated downregulation of PHLPP contributes to arsenic-induced Akt activation and carcinogenesis.Toxicol Sci. 2011 Oct;123(2):411-20. | ||||
| REF 6 | A novel estrogen receptor-microRNA 190a-PAR-1-pathway regulates breast cancer progression, a finding initially suggested by genome-wide analysis of loci associated with lymph-node metastasis.Hum Mol Genet. 2014 Jan 15;23(2):355-67. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.