Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T54582 | Target Info | |||
| Target Name | Nicotinamide phosphoribosyltransferase (NAMPT) | ||||
| Synonyms | Visfatin; PreBcell colonyenhancing factor 1; PreB cellenhancing factor; Pre-B-cell colony-enhancing factor 1; Pre-B cell-enhancing factor; PBEF1; PBEF; Nampt; NAmPRTase | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | NAMPT | ||||
| Biochemical Class | Glycosyltransferases | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-223-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugucaguuugucaaauacccca | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Microarray | [2] | |||
| Representative Target(s) Regulated by This miRNA | ATM serine/threonine kinase (ATM) | Target Info | |||
| C-X-C motif chemokine 2 (CXCL2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-26b-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uucaaguaauucaggauaggu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | NAMPT is a target of miR-26b. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Target Info | |||
| Collagen I (COL1A2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-34a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggcagugucuuagcugguugu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Overexpression of miR-34a inhibited the activities of luciferase reporters containing either the NAMPT WT sequence. | [4] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [4] | |||
| Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
| Androgen receptor (AR) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | lncRNA GAS5/miR-223/NAMPT axis modulates the cell proliferation and senescence of endothelial progenitor cells through PI3K/AKT signaling. J Cell Biochem. 2019 Sep;120(9):14518-14530. | ||||
| REF 2 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 3 | Nicotinamide phosphoribosyl transferase (Nampt) is a target of microRNA-26b in colorectal cancer cells. PLoS One. 2013 Jul 29;8(7):e69963. | ||||
| REF 4 | Elevated microRNA-34a in obesity reduces NAD+ levels and SIRT1 activity by directly targeting NAMPT. Aging Cell. 2013 Dec;12(6):1062-72. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.