Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T53904 |
Target Info
|
| Target Name |
HIF-prolyl hydroxylase 1 (HPH-1) |
| Synonyms |
Prolyl hydroxylase domain-containing protein 1; PHD1; Hypoxia-inducible factor prolyl hydroxylase 1; HPH-3; HIF-PH1; HIF-PH; Estrogen-induced tag6; Estrogen-induced tag 6; Egl nine homolog 2; EIT6; EIT-6 |
| Target Type |
Successful Target |
| Gene Name |
EGLN2 |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-205-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uccuucauuccaccggagucug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
EGLN2 is a direct target of miR-205. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot? |
[2] |
| Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Downregulation of miR-205 modulates cell susceptibility to oxidative and endoplasmic reticulum stresses in renal tubular cells. PLoS One. 2012;7(7):e41462.
|
| REF 2 |
Overexpression of long non-coding RNA NORAD promotes invasion and migration in malignant melanoma via regulating the MIR-205-EGLN2 pathway. Cancer Med. 2019 Apr;8(4):1744-1754.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
