Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T50823 |
Target Info
|
| Target Name |
Semaphorin-4D (SEMA4D) |
| Synonyms |
SEMAJ; GR3; CD100; C9orf164; BB18; A8 |
| Target Type |
Clinical trial Target |
| Gene Name |
SEMA4D |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-214-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acagcaggcacagacaggcagu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Overexpression of miR-214 inhibited SEMA4D expression suggesting that miR-214 played a negative regulatory role in SEMA4D expression. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activating transcription factor 4 (ATF-4)
|
Target Info
|
|
|
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-214 suppressed ovarian cancer and negatively regulated semaphorin 4D. Tumour Biol. 2016 Jun;37(6):8239-48.
|
| REF 2 |
Plexin-B1 is a target of miR-214 in cervical cancer and promotes the growth and invasion of HeLa cells.Int J Biochem Cell Biol. 2011 Apr;43(4):632-41.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
