Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T50574 Target Info
Target Name Leukocyte antigen MIC3 (CD9)
Synonyms p24; Tspan29; Tspan-29; Tetraspanin29; Tetraspanin-29; Motilityrelated protein; Motility-related protein; MRP-1; MIC3; GIG2; Cell growthinhibiting gene 2 protein; Cell growth-inhibiting gene 2 protein; CD9 antigen; 5H9 antigen
Target Type Literature-reported Target
Gene Name CD9
Biochemical Class Tetraspanin
UniProt ID
P21926
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
References  Top
REF 1 Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.