Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T49507 |
Target Info
|
Target Name |
Ephrin type-B receptor 4 (EPHB4) |
Synonyms |
Tyrosine-protein kinase TYRO11; TYRO11; MYK1; Hepatoma transmembrane kinase; HTK |
Target Type |
Clinical trial Target |
Gene Name |
EPHB4 |
Biochemical Class |
Kinase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-20b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcucauagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
EPHB4 is the direct target of miR-20b. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 2 (CDK2)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
References |
Top |
REF 1 |
Preeclampsia up-regulates angiogenesis-associated microRNA (i.e., miR-17, -20a, and -20b) that target ephrin-B2 and EPHB4 in human placenta. J Clin Endocrinol Metab. 2012 Jun;97(6):E1051-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.