Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T46814 Target Info
Target Name Liver organic anion transporter 1 (SLCO1B1)
Synonyms Solute carrier organic anion transporter family member 1B1; Solute carrier family 21 member 6; Sodium-independent organic anion-transporting polypeptide 2; SLC21A6; OATPC; OATP2; OATP-C; OATP-2; Liver-specific organic anion transporter 1; LST1; LST-1
Target Type Literature-reported Target
Gene Name SLCO1B1
Biochemical Class Organo anion transporter
UniProt ID
Q9Y6L6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-511-5p miRNA Info
miRNA Mature AC
MIMAT0002808
Sequence gugucuuuugcucugcaguca
miRNA Species Homo sapiens
Regulation Mechanism SLCO1B1 is the target gene of miR-511. The expressions of SLCO1B1 decreased if transfecting Chang liver cells with miR-511. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA FK506-binding protein 5 (FKBP5) Target Info
FKBP5_HUMAN
Liver organic anion transporter 1 (SLCO1B1) Target Info
SO1B1_HUMAN
References  Top
REF 1 Role of miR-511 in the Regulation of OATP1B1 Expression by Free Fatty Acid. Biomol Ther (Seoul). 2015 Sep;23(5):400-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.