Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T46365 Target Info
Target Name M-phase inducer phosphatase 2 (MPIP2)
Synonyms Dual specificity phosphatase Cdc25B; Cdc25B phosphatase; CDC25HU2
Target Type Clinical trial Target
Gene Name CDC25B
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P30305
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Reporter Assay; Western Blot [1]
2 Western Blot [1]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target CDC25B. [2]
Evidence Score (E-score) 1 +
1 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-148a is down-regulated in human pancreatic ductal adenocarcinomas and regulates cell survival by targeting CDC25B. Lab Invest. 2011 Oct;91(10):1472-9.
REF 2 Network modeling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis. PLoS Comput Biol. 2010 Apr 1;6(4):e1000730.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.