Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T44513 Target Info
Target Name Normal cross-reacting antigen (CD66c)
Synonyms Nonspecific crossreacting antigen; Non-specific crossreacting antigen; NCA; Carcinoembryonic antigen-related cell adhesion molecule 6; CD66c antigen
Target Type Clinical trial Target
Gene Name CEACAM6
Biochemical Class Immunoglobulin
UniProt ID
P40199
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29a targets CEACAM6 directly in lung adenocarcinoma. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 MicroRNA-29a suppresses the growth, migration, and invasion of lung adenocarcinoma cells by targeting carcinoembryonic antigen-related cell adhesion molecule 6. FEBS Lett. 2014 Oct 16;588(20):3744-50.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.