Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T43189 |
Target Info
|
| Target Name |
Tubulin (TUB) |
| Synonyms |
Human tubulin |
| Target Type |
Successful Target |
| Gene Name |
NO-GeName |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-200c-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaauacugccggguaaugaugga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
TUBB3 was a direct target of miR-200c. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay |
[1] |
| 2 |
qPCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-200c mitigates invasiveness and restores sensitivity to microtubule-targeting chemotherapeutic agents. Mol Cancer Ther. 2009 May;8(5):1055-66.
|
| REF 2 |
The miR-200 family controls beta-tubulin III expression and is associated with paclitaxel-based treatment response and progression-free survival in... Endocr Relat Cancer. 2010 Dec 21;18(1):85-95.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
