Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40890 Target Info
Target Name Zinc finger protein GLI1 (Gli1)
Synonyms Oncogene GLI; Glioma-associated oncogene; GLI
Target Type Patented-recorded Target
Gene Name GLI1
UniProt ID
P08151
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-324-5p miRNA Info
miRNA Mature AC
MIMAT0000761
Sequence cgcauccccuagggcauuggugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-324-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target GLI1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [2]
2 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b overexpression could repress the metastasis of GC cells in vitro and in vivo by directly targeting the Gli1 transcription factor and inhibiting expression of the Gli1 target genes OPN and Zeb2. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-202-3p miRNA Info
miRNA Mature AC
MIMAT0002811
Sequence agagguauagggcaugggaa
miRNA Species Homo sapiens
Regulation Mechanism miR-202-3p could inhibit the growth and induce apoptosis of GC cells both in vitro and in vivo by directly targeting the transcription factor Gli1 and inhibiting expression of Gli1 target genes b-catenin and BCL-2. [5]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA B-cell-activating factor (TNFSF13B) Target Info
TN13B_HUMAN
LDL receptor related protein-6 (LRP-6) Target Info
LRP6_HUMAN
References  Top
REF 1 MicroRNA control of signal transduction. Nat Rev Mol Cell Biol. 2010 Apr;11(4):252-63.
REF 2 Concerted microRNA control of Hedgehog signalling in cerebellar neuronal progenitor and tumour cells. EMBO J. 2008 Oct 8;27(19):2616-27.
REF 3 MicroRNA-326 sensitizes human glioblastoma cells to curcumin via the SHH/GLI1 signaling pathway. Cancer Biol Ther. 2018 Apr 3;19(4):260-270.
REF 4 MiR-133b is frequently decreased in gastric cancer and its overexpression reduces the metastatic potential of gastric cancer cells. BMC Cancer. 2014 Jan 21;14:34.
REF 5 Decrease of miR-202-3p expression, a novel tumor suppressor, in gastric cancer. PLoS One. 2013 Jul 25;8(7):e69756.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.