Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T40787 |
Target Info
|
Target Name |
S-methyl-5'-thioadenosine phosphorylase (MTAP) |
Synonyms |
Methylthioadenosine phosphorylase; MTAPase; MTA phosphorylase; MSAP; 5'-methylthioadenosine phosphorylase |
Target Type |
Literature-reported Target |
Gene Name |
MTAP |
Biochemical Class |
Glycosyltransferases |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcuuaucagacugauguuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot; Northern Blot; qRT-PCR |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-21 down-regulates the expression of tumor suppressor PDCD4 in human glioblastoma cell T98G. Cancer Lett. 2008 Dec 18;272(2):197-205.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.