Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40097 Target Info
Target Name Stress-activated protein kinase JNK1 (JNK1)
Synonyms Stress-activated protein kinase 1c; SAPK1c; PRKM8; Mitogen-activated protein kinase 8; MAPK 8; MAP kinase 8; JNK-46; C-Jun N-terminal kinase 1
Target Type Clinical trial Target
Gene Name MAPK8
Biochemical Class Kinase
UniProt ID
P45983
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Western Blot; Reporter Assay; [1]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
References  Top
REF 1 MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life. 2009 Nov;61(11):1075-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.